Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr03G000859`

Chromosome: Chr03 Coordinates: 9813814-9819437 Strand: - Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr03G000859`
Name	SmilChr03G000859
Description	protein LUTEIN DEFICIENT 5, chloroplastic
Chromosome / SeqID	Chr03 / NC_080389.1
Coordinates and Strand	9813814 - 9819437 / `-`

ID Mapping

NCBI Gene ID	`LOC131017455`
GeneID	`131017455`
locus_tag	`-`
NCBI Name	`LOC131017455`
Original query	`SmilChr03G000859`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; NCBI GO GAF; KEGG smil; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	protein LUTEIN DEFICIENT 5, chloroplastic
Product	protein LUTEIN DEFICIENT 5%2C chloroplastic
Arabidopsis	`AT1G31800` (CYP97A3) cytochrome P450, family 97, subfamily A, polypeptide 3 [Source:NCBI gene (formerly Entrezgene);Acc:840067] identity=78.2; qcov=0.915; evalue=0; confidence=high
Rice	`Os02g0817900` (CYP97A4) - identity=75; qcov=0.895; evalue=0; confidence=high
GO	GO:0005506 (iron ion binding); GO:0009507 (chloroplast); GO:0010291 (beta-carotene 3-hydroxylase activity); GO:0016123 (xanthophyll biosynthetic process); GO:0016705 (oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen); GO:0020037 (heme binding)
KEGG	smil00906 (Carotenoid biosynthesis - Salvia miltiorrhiza (redroot sage)); smil01100 (Metabolic pathways - Salvia miltiorrhiza (redroot sage)); smil01110 (Biosynthesis of secondary metabolites - Salvia miltiorrhiza (redroot sage))
Pfam	PF00067 (p450)
InterPro	-
eggNOG	-
NR	GeneID:131017455

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Chloroplast	叶绿体	1.00000	`XP_057802194.1`
2	Chloroplast membrane	叶绿体膜	1.00000	`XP_057802194.1`
3	Chloroplast thylakoid	类囊体	0.20000	`XP_057802194.1`
4	Nucleus	细胞核	0.00000	`XP_057802194.1`
5	Chromosome	染色体	0.00000	`XP_057802194.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr3:9814076`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B19
`Chr3:9814094`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B99
`Chr3:9814183`	`AT`	`A`	1bp_deletion	frameshift_variant	1	B94
`Chr3:9814183`	`AT`	`A`	1bp_deletion	CDS_variant	1	B94
`Chr3:9814550`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B99
`Chr3:9814562`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B29
`Chr3:9814572`	`G`	`A`	EMS_canonical_SNV	CDS_variant	5	B115,B23,B69,B71,D4
`Chr3:9814761`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B99
`Chr3:9815165`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	B20
`Chr3:9816960`	`G`	`A`	EMS_canonical_SNV	CDS_variant	5	A25,B121,B130,B50,C29
`Chr3:9816984`	`G`	`A`	EMS_canonical_SNV	CDS_variant	2	A18,B33
`Chr3:9817107`	`G`	`A`	EMS_canonical_SNV	CDS_variant	5	A5,B1,B126,B68,D1

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057802194.1

612 aa

306

612

p450

PF00067 p450 139-562 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057802194.1`	Pfam	`PF00067`	p450	Domain	139	562	1.4e-87	295.1	Cytochrome P450

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057946211.1
AGATTCCTCCGTTTGTTCGTTAGCAGTTGGGTGGCCTAATATTACTAACGCCACCCCGATATTGATATCGACAGATCATCGTGCTATTTTCTAAGTAGTACATAACGCATCGCGTATTGTACAGTCTGCCTGGCATTAGAGAATCTTTCTCAGCAGTTGTGGCAGACTGCCGACTTACAGTTAACTTATCGTCTTCGTCTCTCCTATCGCCTTTCTCTCTCTAAAACAACAATGTCTGCGAGTCTATCCTTCCATCAATT...

CDS

1 records

Download CDS FASTA

LOC131017455
ATGTCTGCGAGTCTATCCTTCCATCAATTCTCGCCGCATACGTTTCAGACGAGAGACTGGAGGAGGAGATTCAACCCAGCTGTTAATTTGAAGTTCAATGGGAATTCTATGGTTAGCTGCTCGTTGTCGGGTAATGGGAGAGGAGGAGGGCCCGGAGATGATGCGGTGAAAGATGTGGAGAGGCTTTTGGAAGAGAAGCGGCGGGCGGAGCTCTCGGCGCGAATAGCATCCGGCGAATTTACAGTTGAGAAGCCAAGCTT...

Protein

1 records

Download Protein FASTA

XP_057802194.1
MSASLSFHQFSPHTFQTRDWRRRFNPAVNLKFNGNSMVSCSLSGNGRGGGPGDDAVKDVERLLEEKRRAELSARIASGEFTVEKPSFQSKLKDGLSKLGLPKEIVEFIVNVIGGSGDLKIPEARGSIAAIRDEPFFIPLYELYLTYGGIFRLTFGPKSFLIVSDPSIAKHILKDNPKSYSKGILAEILDFVMGKGLIPADGEIWRVRRRAIVPALHQKFVAAMFSLFGDATDRLCKKLDTAASDGEDVEMESLFSRLTLD...

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser