Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr05G003307`

Chromosome: Chr05 Coordinates: 43333291-43333965 Strand: + Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr05G003307`
Name	SmilChr05G003307
Description	uncharacterized SmilChr05G003307
Chromosome / SeqID	Chr05 / NC_080391.1
Coordinates and Strand	43333291 - 43333965 / `+`

ID Mapping

NCBI Gene ID	`LOC131025961`
GeneID	`131025961`
locus_tag	`-`
NCBI Name	`LOC131025961`
Original query	`LOC131025961`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	Late embryosis abundant (LEA) hydroxyproline-rich glycoprotein family [Source:NCBI gene (formerly Entrezgene);Acc:819222]; symbol=AT2G46150; hit=AT2G46150; species=arabidopsis; confidence=high
Product	Late embryosis abundant (LEA) hydroxyproline-rich glycoprotein family [Source:NCBI gene (formerly Entrezgene);Acc:819222]; symbol=AT2G46150; hit=AT2G46150; species=arabidopsis; confidence=high
Arabidopsis	`AT2G46150` (AT2G46150) Late embryosis abundant (LEA) hydroxyproline-rich glycoprotein family [Source:NCBI gene (formerly Entrezgene);Acc:819222] identity=45.2; qcov=1.02; evalue=1.09e-52; confidence=high
Rice	`Os01g0736500` - identity=35.2; qcov=1.01; evalue=3.38e-27; confidence=medium
GO	-
KEGG	-
Pfam	PF03168 (LEA_2)
InterPro	-
eggNOG	-
NR	GeneID:131025961

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Cell membrane	细胞膜	1.00000	`XP_057811724.1`
2	Nucleus	细胞核	0.00000	`XP_057811724.1`
3	Chromosome	染色体	0.00000	`XP_057811724.1`
4	Centromere	着丝粒	0.00000	`XP_057811724.1`
5	Chromatin	染色质	0.00000	`XP_057811724.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr5:43333515`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	B31
`Chr5:43333569`	`C`	`T`	EMS_canonical_SNV	CDS_variant	2	B127,D2
`Chr5:43333677`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B122
`Chr5:43333703`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B122
`Chr5:43333750`	`G`	`A`	EMS_canonical_SNV	CDS_variant	2	B108,B122
`Chr5:43333770`	`G`	`A`	EMS_canonical_SNV	CDS_variant	3	B108,B122,D11

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057811724.1

224 aa

112

224

LEA_2

PF03168 LEA_2 108-202 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057811724.1`	Pfam	`PF03168`	LEA_2	Domain	108	202	3.6e-08	34.5	Late embryogenesis abundant protein

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057955741.1
ATGTCCGACAAGAAAGAGCAAGTGAAGCCCTTGGCGCCGGCGGCGCACCGTGTCGACATCGACGACTACGACCGCTCCGACGCCTTCTCGGTGGAGCTGGCCTCGCACCTCTGCCACAGCCGCCAGAAGTGCATCAAGCTCTGCGGCTGCTGCGCTGCGATCCTACTGATCGCGGTGACGGTGGTGCTAGTGCTCATGTTCACCGTCTTTCACGTCAAAGATCCGTCGCTAAAGATGAACTCTGTCGCGGTTCACGGCGT...

CDS

1 records

Download CDS FASTA

LOC131025961
ATGTCCGACAAGAAAGAGCAAGTGAAGCCCTTGGCGCCGGCGGCGCACCGTGTCGACATCGACGACTACGACCGCTCCGACGCCTTCTCGGTGGAGCTGGCCTCGCACCTCTGCCACAGCCGCCAGAAGTGCATCAAGCTCTGCGGCTGCTGCGCTGCGATCCTACTGATCGCGGTGACGGTGGTGCTAGTGCTCATGTTCACCGTCTTTCACGTCAAAGATCCGTCGCTAAAGATGAACTCTGTCGCGGTTCACGGCGT...

Protein

1 records

Download Protein FASTA

XP_057811724.1
MSDKKEQVKPLAPAAHRVDIDDYDRSDAFSVELASHLCHSRQKCIKLCGCCAAILLIAVTVVLVLMFTVFHVKDPSLKMNSVAVHGVGELDRRTGSGPGRNLTFDFEVEVKNPNVASFKFGNTTTFLYYGGSLVGEATGQAGEARARKRVRMDVSVGVMVDKIMGVERLGNDLSVGILSISSYTRISGKVKITQAIKKSVVVVKLNCTMNLIVRTQGIQDLKCT

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser