Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr02G003861`

Chromosome: Chr02 Coordinates: 60531564-60532579 Strand: + Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr02G003861`
Name	SmilChr02G003861
Description	ethylene-responsive transcription factor ERF010-like
Chromosome / SeqID	Chr02 / NC_080388.1
Coordinates and Strand	60531564 - 60532579 / `+`

ID Mapping

NCBI Gene ID	`LOC131010804`
GeneID	`131010804`
locus_tag	`-`
NCBI Name	`LOC131010804`
Original query	`SmilChr02G003861`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; NCBI GO GAF; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	ethylene-responsive transcription factor ERF010-like
Product	ethylene-responsive transcription factor ERF010-like
Arabidopsis	`AT5G67190` (DEAR2) DREB and EAR motif protein 2 [Source:NCBI gene (formerly Entrezgene);Acc:836854] identity=76.5; qcov=0.653; evalue=5.07e-50; confidence=medium
Rice	`Os04g0648900` (OsERF#008) - identity=48.5; qcov=1.14; evalue=8.67e-42; confidence=medium
GO	GO:0003677 (DNA binding); GO:0003700 (DNA-binding transcription factor activity); GO:0006355 (regulation of DNA-templated transcription)
KEGG	-
Pfam	PF00847 (AP2)
InterPro	-
eggNOG	-
NR	GeneID:131010804

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Nucleus	细胞核	1.00000	`XP_057794447.1`
2	Chromosome	染色体	0.00000	`XP_057794447.1`
3	Centromere	着丝粒	0.00000	`XP_057794447.1`
4	Chromatin	染色质	0.00000	`XP_057794447.1`
5	Telomere	端粒	0.00000	`XP_057794447.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr2:60532070`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	C78
`Chr2:60532152`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B33
`Chr2:60532216`	`C`	`T`	EMS_canonical_SNV	CDS_variant	3	B107,B13,B140
`Chr2:60532305`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B131
`Chr2:60532308`	`G`	`A`	EMS_canonical_SNV	CDS_variant	2	B107,B140

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057794447.1

150 aa

150

AP2

PF00847 AP2 33-81 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057794447.1`	Pfam	`PF00847`	AP2	Domain	33	81	3.8e-11	43.8	AP2 domain

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057938464.1
TTTTTCTTTTCTTTTTTAAATAACAAATCTTATGTATATAAGTTACAACTAACGACACACGTACACTAGGTTAACAGAAAAATAAAATAAAAAATAAAATGCGGACTAAACATAATAGTATTACTAAAAAAAATCCAACATAGAAATCCACGAACCCTTCTTCTCCACCTCCATATAAATAAGACGCCATCACCATAACCCCAGCGTTTCCTGCTTCTTTGCTTTGCTGCCTTTTATTCTTACACATCTCATGTTTTCTC...

CDS

1 records

Download CDS FASTA

LOC131010804
ATGGAAAGCGTCTGCTGCGCGACGTCGTCCACGTCCTCGTCAAGCTCCGAGAATCCCAACAAGCGGAAGCAGCGCCAGCGCGCGGCGGATAAGCCTTACCGCGGGATTCGGATGCGCAAGTGGGGTAAATGGGTGGCGGAGATCAGGGAGCCCAACAAACGCTCCAGAATCTGGCTCGGCTCCTACTCCTCCCCCGTCGCGGCGGCGCGCGCCTACGACACGGCGGTCTTCCACCTCCGCGGCCCCACCGCGCGCCTCAA...

Protein

1 records

Download Protein FASTA

XP_057794447.1
MESVCCATSSTSSSSSENPNKRKQRQRAADKPYRGIRMRKWGKWVAEIREPNKRSRIWLGSYSSPVAAARAYDTAVFHLRGPTARLNFPECVPEYGTAAADLPAAAIRKKATEVGARVDALQAAGAIKSGRAPQKPDLNEYPSPESSEEN

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser