Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr03G002642`

Chromosome: Chr03 Coordinates: 42017140-42020606 Strand: + Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr03G002642`
Name	SmilChr03G002642
Description	ras-related protein RABH1b-like
Chromosome / SeqID	Chr03 / NC_080389.1
Coordinates and Strand	42017140 - 42020606 / `+`

ID Mapping

NCBI Gene ID	`LOC131015833`
GeneID	`131015833`
locus_tag	`-`
NCBI Name	`LOC131015833`
Original query	`SmilChr03G002642`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; NCBI GO GAF; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	ras-related protein RABH1b-like
Product	ras-related protein RABH1b-like
Arabidopsis	`AT2G44610` (RAB6A) Ras-related small GTP-binding family protein [Source:NCBI gene (formerly Entrezgene);Acc:819069] identity=95.2; qcov=1; evalue=8.44e-148; confidence=high
Rice	`Os07g0496000` (OsRab6A1) - identity=93.3; qcov=1; evalue=5.46e-137; confidence=high
GO	GO:0003924 (GTPase activity); GO:0005525 (GTP binding)
KEGG	-
Pfam	PF00009 (GTP_EFTU); PF00025 (Arf); PF00071 (Ras); PF01926 (MMR_HSR1); PF04670 (Gtr1_RagA); PF08477 (Roc); PF09439 (SRPRB)
InterPro	-
eggNOG	-
NR	GeneID:131015833

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Cytoplasmic vesicle	细胞质囊泡	1.00000	`XP_057800252.1`
2	Golgi apparatus	高尔基体	1.00000	`XP_057800252.1`
3	Trans-golgi network	Trans-golgi network	1.00000	`XP_057800252.1`
4	Vesicle	囊泡	1.00000	`XP_057800252.1`
5	Endosome	内体	1.00000	`XP_057800252.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr3:42018002`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	B94
`Chr3:42018690`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	C14
`Chr3:42019859`	`C`	`T`	EMS_canonical_SNV	CDS_variant	1	B1
`Chr3:42019875`	`G`	`A`	EMS_canonical_SNV	CDS_variant	5	A21,B136,B52,B66,C41

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057800252.1

208 aa

104

208

Arf

Roc

Gtr1_RagA

SRPRB

Ras

MMR_HSR1

GTP_EFTU

PF00025 Arf 9-165 aa PF08477 Roc 11-125 aa PF04670 Gtr1_RagA 11-133 aa PF09439 SRPRB 11-135 aa PF00071 Ras 11-169 aa PF01926 MMR_HSR1 12-119 aa PF00009 GTP_EFTU 43-171 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057800252.1`	Pfam	`PF00025`	Arf	Domain	9	165	5.5e-15	56.0	ADP-ribosylation factor family
`XP_057800252.1`	Pfam	`PF08477`	Roc	Domain	11	125	1.3e-37	129.4	Ras of Complex, Roc, domain of DAPkinase
`XP_057800252.1`	Pfam	`PF04670`	Gtr1_RagA	Domain	11	133	4.9e-05	23.6	Gtr1/RagA G protein conserved region
`XP_057800252.1`	Pfam	`PF09439`	SRPRB	Domain	11	135	1.1e-05	25.6	Signal recognition particle receptor beta subunit
`XP_057800252.1`	Pfam	`PF00071`	Ras	Domain	11	169	1.5e-58	197.6	Ras family
`XP_057800252.1`	Pfam	`PF01926`	MMR_HSR1	Family	12	119	0.00012	22.9	50S ribosome-binding GTPase
`XP_057800252.1`	Pfam	`PF00009`	GTP_EFTU	Domain	43	171	5.7e-08	33.3	Elongation factor Tu GTP binding domain

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057944269.1
TAAAAAATTAAATTAATGCTTGCATTTCTTGACTCGGACGAAGACAAGTCCTAAAACCCAATTAGTTCTCGCAACTGCAAGCCTACAAGTTTCTCCTCATCGATTCCTCCGGTTAAATCTCCGGTCATTTTTCCGGCGAGATCTCGACCTTCCGTCGGAAAAATCGGCGCTCTGGCCGAAGTCGAAGATCTGATCCTTTTTGCATTAAACCCACCCGACCTGGATTGATGGCTCCGGTCTCGGCTCTCGCCAAGTATAAA...

CDS

1 records

Download CDS FASTA

LOC131015833
ATGGCTCCGGTCTCGGCTCTCGCCAAGTATAAATTAGTGTTTTTGGGGGATCAATCAGTCGGTAAAACGAGCATCATTACTCGATTCATGTACGATAAATTTGACAACACTTATCAGGCGACTATTGGAATTGATTTCCTTTCCAAGACTATGTATCTTGAAGATCGAACTGTACGGTTGCAATTATGGGATACTGCAGGACAAGAGAGATTTAGGAGTCTCATCCCAAGCTATATAAGAGACTCCTCTGTTGCAGTCAT...

Protein

1 records

Download Protein FASTA

XP_057800252.1
MAPVSALAKYKLVFLGDQSVGKTSIITRFMYDKFDNTYQATIGIDFLSKTMYLEDRTVRLQLWDTAGQERFRSLIPSYIRDSSVAVIVYDVASRQSFLNTAKWIEEVRTERGSDVIIVLVGNKTDLVDKRQVSIEEAEAKARELNVMFIETSAKAGFNIKPLFRKIAAALPGMETLSSAKQEDMVDVNLKSGNNNASQSQQQSGGCAC

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser