Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr03G003070`

Chromosome: Chr03 Coordinates: 47695414-47696430 Strand: - Biotype: lncRNA

Basic Information

Standard Gene ID	`SmilChr03G003070`
Name	SmilChr03G003070
Description	uncharacterized SmilChr03G003070
Chromosome / SeqID	Chr03 / NC_080389.1
Coordinates and Strand	47695414 - 47696430 / `-`

ID Mapping

NCBI Gene ID	`LOC131016217`
GeneID	`131016217`
locus_tag	`-`
NCBI Name	`LOC131016217`
Original query	`SmilChr03G003070`

Open ID mapping

Functional Annotation

Source	GFF basic annotation
Description	uncharacterized SmilChr03G003070
Product	uncharacterized SmilChr03G003070
Arabidopsis	`-` -
Rice	`-` -
GO	-
KEGG	-
Pfam	-
InterPro	-
eggNOG	-
NR	GeneID:131016217

Open annotation module

Subcellular Localization Top 5

Subcellular localization is still building, or no prediction is available for this gene yet.

Open subcellular search

EMS Mutant Variants

No curated EMS CDS / LoF variants are available for this gene yet, or the EMS database is still building.

Open EMS variants

Predicted Protein Domains

This gene has no available Pfam domain hit in the current release.

Open domain search

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XR_009098886.1
GAGTAAGAATATTGTTGGTGTTCTTAACTCAAGAGAAATGTTTTTAATTATTTATTCATTAAAGTTTAAAAACCCGGCTAAGTGAATCATAGAATATTAAGCACTACACCATGACTTAAGATTAGCTTCACGAGACCTATTAAGAATAGAATTTCTTGTAGGCTTTGTGACCAGGGGGATTAGCGCTGCTTTCCCAAGACAGGTTTATAAGTGATTATGATCTTCAGGCTTTGCCTAACCAGGTTGGCTGGCCGGTGCTG...

CDS

0 records

CDS or protein sequence does not apply to this noncoding RNA.

Protein

0 records

CDS or protein sequence does not apply to this noncoding RNA.

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser