Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr04G003169`

Chromosome: Chr04 Coordinates: 48316552-48322428 Strand: + Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr04G003169`
Name	SmilChr04G003169
Description	calmodulin-lysine N-methyltransferase-like
Chromosome / SeqID	Chr04 / NC_080390.1
Coordinates and Strand	48316552 - 48322428 / `+`

ID Mapping

NCBI Gene ID	`LOC131023963`
GeneID	`131023963`
locus_tag	`-`
NCBI Name	`LOC131023963`
Original query	`SmilChr04G003169`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; NCBI GO GAF; KEGG smil; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	calmodulin-lysine N-methyltransferase-like
Product	calmodulin-lysine N-methyltransferase-like
Arabidopsis	`AT4G35987` (AT4G35987) S-adenosyl-L-methionine-dependent methyltransferases superfamily protein [Source:NCBI gene (formerly Entrezgene);Acc:829754] identity=59.7; qcov=0.971; evalue=2.75e-138; confidence=high
Rice	`Os03g0243800` - identity=53.3; qcov=1.01; evalue=6.67e-112; confidence=high
GO	GO:0005737 (cytoplasm); GO:0018025 (calmodulin-lysine N-methyltransferase activity)
KEGG	smil00310 (Lysine degradation - Salvia miltiorrhiza (redroot sage)); smil01100 (Metabolic pathways - Salvia miltiorrhiza (redroot sage))
Pfam	PF05175 (MTS); PF10294 (Methyltransf_16)
InterPro	-
eggNOG	-
NR	GeneID:131023963

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Nucleus	细胞核	1.00000	`XP_057809616.1`
2	Cytoplasm	细胞质	1.00000	`XP_057809616.1`
3	Cytosol	细胞质基质	0.20000	`XP_057809616.1`
4	Chromosome	染色体	0.00000	`XP_057809616.1`
5	Centromere	着丝粒	0.00000	`XP_057809616.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr4:48316681`	`G`	`A`	EMS_canonical_SNV	CDS_variant	4	B47,C2,C71,C82
`Chr4:48320509`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	B90

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057809616.1

314 aa

157

314

Methyltransf_16

MTS

PF10294 Methyltransf_16 121-263 aa PF05175 MTS 132-218 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057809616.1`	Pfam	`PF10294`	Methyltransf_16	Family	121	263	6.6e-22	78.8	Lysine methyltransferase
`XP_057809616.1`	Pfam	`PF05175`	MTS	Domain	132	218	9.4e-06	26.0	Methyltransferase small domain

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057953633.1
CAACAACTGGAGGTGCAAAATTACATAACATAGTTGTAGTTAGCTGATCAACTGTTCAAATTCACAGAACAAGGAACGACGTCGCTCGACGTGGCAACGCCAATGATGAAGCCTGATCAGCCACAGTCAGCGCCAAAGCCGTCGTCTTTGCGGTGGCAAATCCTCCGCCGCGCTCTTCTCCGCCGTCCATCCAATTCCCATGATTCCAGTGAAAACATCAGTTTAGACACAGTATCGCGACGAACGAGAAGTGGATTCAA...

CDS

1 records

Download CDS FASTA

LOC131023963
ATGATGAAGCCTGATCAGCCACAGTCAGCGCCAAAGCCGTCGTCTTTGCGGTGGCAAATCCTCCGCCGCGCTCTTCTCCGCCGTCCATCCAATTCCCATGATTCCAGTGAAAACATCAGTTTAGACACAGTATCGCGACGAACGAGAAGTGGATTCAATCTGATACCGTGCCATTTGGTGAATGACGGCGGCGAAGATCCGGATTCTTTATCTAGGAGAGATGTTTGTTTCCGCTACACATTGCCTCTTCCTAGTGCTCC...

Protein

1 records

Download Protein FASTA

XP_057809616.1
MMKPDQPQSAPKPSSLRWQILRRALLRRPSNSHDSSENISLDTVSRRTRSGFNLIPCHLVNDGGEDPDSLSRRDVCFRYTLPLPSAPELCLRQRWEDCVDLNDFEVCNRYDIDNTGLVCQWPSEDVLAYYCMSHLDYFRNKRVIELGSGYGLAGFVIAMAAEALEVVISDGNPQVVDYIQHNININSAALGSTKVKSMILHWDQHVVSDISGTFDIIVASDCTFFKKFHKGLARTIRCLLKEHGPSEAILFSPKRGDSLD...

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser