Gene Card

Search by standard ID, NCBI Gene ID, GeneID, locus tag, transcript ID, protein ID, or a manually reviewed literature gene name. The page resolves the query to a Red Sage gene and integrates coordinates, sequences, annotations, subcellular localization, EMS variants, and downloads.

Resolved gene

`SmilChr05G003808`

Chromosome: Chr05 Coordinates: 51381944-51384707 Strand: - Biotype: protein_coding

Basic Information

Standard Gene ID	`SmilChr05G003808`
Name	SmilChr05G003808
Description	probable phospholipid hydroperoxide glutathione peroxidase
Chromosome / SeqID	Chr05 / NC_080391.1
Coordinates and Strand	51381944 - 51384707 / `-`

ID Mapping

NCBI Gene ID	`LOC131024873`
GeneID	`131024873`
locus_tag	`-`
NCBI Name	`LOC131024873`
Original query	`SmilChr05G003808`

Open ID mapping

Functional Annotation

Source	GFF basic annotation; NCBI GO GAF; KEGG smil; Pfam-A/HMMER; Arabidopsis/Rice homolog
Description	probable phospholipid hydroperoxide glutathione peroxidase
Product	probable phospholipid hydroperoxide glutathione peroxidase
Arabidopsis	`AT2G25080` (GPX1) glutathione peroxidase 1 [Source:NCBI gene (formerly Entrezgene);Acc:817046] identity=77.1; qcov=0.892; evalue=8.59e-117; confidence=high
Rice	`Os06g0185900` (OsGpx4) - identity=86.4; qcov=0.733; evalue=2.12e-113; confidence=high
GO	GO:0004602 (glutathione peroxidase activity); GO:0006979 (response to oxidative stress)
KEGG	smil00480 (Glutathione metabolism - Salvia miltiorrhiza (redroot sage)); smil01100 (Metabolic pathways - Salvia miltiorrhiza (redroot sage))
Pfam	PF00255 (GSHPx); PF00578 (AhpC-TSA); PF08534 (Redoxin)
InterPro	-
eggNOG	-
NR	GeneID:131024873

Open annotation module

Subcellular Localization Top 5

Rank	Location	Chinese	Score	Protein ID
1	Chloroplast	叶绿体	1.00000	`XP_057810407.1`
2	Chloroplast stroma	叶绿体基质	1.00000	`XP_057810407.1`
3	Nucleus	细胞核	0.00000	`XP_057810407.1`
4	Chromosome	染色体	0.00000	`XP_057810407.1`
5	Centromere	着丝粒	0.00000	`XP_057810407.1`

Open subcellular search

EMS Mutant Variants

The table shows the first 12 candidate EMS variants for this gene. Open the EMS module for full filtering and downloads.

Position	REF	ALT	Type	Effect	Carriers	Samples
`Chr5:51382183`	`G`	`A`	EMS_canonical_SNV	CDS_variant	1	B41
`Chr5:51383212`	`C`	`T`	EMS_canonical_SNV	CDS_variant	4	B41,C18,C30,C50
`Chr5:51383410`	`G`	`A`	EMS_canonical_SNV	CDS_variant	4	A24,A7,B4,D10
`Chr5:51384375`	`GC`	`G`	1bp_deletion	frameshift_variant	1	A6
`Chr5:51384375`	`GC`	`G`	1bp_deletion	CDS_variant	1	A6

Open EMS variants

Predicted Protein Domains

Domain results are from the Pfam-A HMM database and HMMER hmmscan; positions are amino-acid coordinates on the corresponding protein sequence.

XP_057810407.1

240 aa

120

240

Redoxin

AhpC-TSA

GSHPx

PF08534 Redoxin 79-153 aa PF00578 AhpC-TSA 80-145 aa PF00255 GSHPx 83-191 aa

Protein ID	Source	Domain ID	Domain name	Type	Start aa	End aa	E-value	Score	Description
`XP_057810407.1`	Pfam	`PF08534`	Redoxin	Domain	79	153	7.3e-09	36.3	Redoxin
`XP_057810407.1`	Pfam	`PF00578`	AhpC-TSA	Domain	80	145	6.2e-08	33.3	AhpC/TSA family
`XP_057810407.1`	Pfam	`PF00255`	GSHPx	Family	83	191	1.7e-43	147.3	Glutathione peroxidase

cDNA / CDS / Protein Sequences

Download genomic DNA (gene region only)

Every public gene has transcript sequence from the reference annotation. Protein-coding genes also have CDS and protein sequences. CDS and protein downloads do not apply to noncoding RNA. Version suffixes of original accessions are retained.

cDNA

1 records

Download cDNA FASTA

XM_057954424.1
CAATGGAACACGTGGCAGTTGTATTCCCCATTCCAAACAAACAAGGAAACACGAGACATCCGATCCACCACGTCCACGAGACCCACATTTCTGTTACCAAACTACTGCGTCCAAAATCCACACACTCAGCGTGTTCCGGCCTCGCCAATGGCTTCCATGTCCTTCTCTTCAGTCTTCTCAGCGCCGCTGCAGAGTTTAGCTCTCAATAAACAGCACCTCCCCTCCAATTCCGTGCTGGCGTTTCTCGAATCGTCGAATTG...

CDS

1 records

Download CDS FASTA

LOC131024873
ATGGCTTCCATGTCCTTCTCTTCAGTCTTCTCAGCGCCGCTGCAGAGTTTAGCTCTCAATAAACAGCACCTCCCCTCCAATTCCGTGCTGGCGTTTCTCGAATCGTCGAATTGGTCGAGTCTCAGCTCTTCGAAATCCACGTTTCTTCGAGATGGCTTCCCCGTTTTATCCCCGATTCTATCTGGCTTCTCTTTCAAATCCCGATCGTTCGCCTCTGTTTACGCCAGAGCTGCTACGGGGAAGACCATTCATGATTTCAG...

Protein

1 records

Download Protein FASTA

XP_057810407.1
MASMSFSSVFSAPLQSLALNKQHLPSNSVLAFLESSNWSSLSSSKSTFLRDGFPVLSPILSGFSFKSRSFASVYARAATGKTIHDFSVKDIDGKDVALSKFKGKVLLIVNVASRCGLTSSNYTELSHIYEKYKTQGLEILAFPCNQFGAQEPGSNEDIKNFACTRFKAEFPIFDKVDVNGPNTAPVYQYLKSSAGGFLGDLVKWNFEKFLVDKNGKVVERYPPTTSPFQIEKDIQKLLAA

Flanking Sequence Downloads

Upstream/downstream length is capped at 10000 bp. Negative-strand genes are reverse-complemented so the exported FASTA follows transcriptional 5′ to 3′ orientation.

Download upstream Download downstream Download upstream + gene + downstream

JBrowse

Open genome browser